circad | circRNAs associated with diseases

circPTK2
Gene	PTK2	Organism	Human
Genome Locus	chr8:141856358-141900868:-	Build	hg19
Disease	Bladder Cancer	ICD-10	Malignant neoplasm of Bladder, unspecified (C67.9)
DBLink	Link to database	PMID	29125888
Experimental Method
Sample Type	Tissues	Comparison	40 pairs of bladder carcinoma tissue, matched para-carcinoma tissue, and metastatic lymph node tissue
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward ATCATACTGGGAGATGCGGG Reverse AGTTGGGGTCAAGGTAAGCA	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Xu, ZQ, Yang, MG, Liu, HJ, Su, CQ (2018). Circular RNA hsa_circ_0003221 (circPTK2) promotes the proliferation and migration of bladder cancer cells. J. Cell. Biochem., 119, 4:3317-3325.